Raw Material

TIANSeq Dual-Index Adapter (Illumina)

TIANSeq Dual-Index Adapter for Illumina 96 types with 8-base indices for DNA/RNA libraries

Catalog Number|Packaging

Mat. No

Ref. No

No. of preps

4995263

GNG216-A 96

4995264

GNG216-B 96

4995265

GNG216-C 96

4995266

GNG216-D 96

4995269

GNG216 384

  • Features

    Easy to choose: The adaptors are divided into four groups: 4995263, 4995264, 4995265, 4995266, to provide maximum of 96 dual-index labeling to choose, according to different experiment needs.

    Easy to use: The kit contains diluent buffer that is highly stable and can be directly used to dilute adaptor solutions.

    Quality control: Strict quality control and functional verification are applied for each batch to ensure adaptors to maintain the accurate sequences.

  • Description

    TIANSeq Dual-Index Adapter (Illumina) is a DNA adapter developed specifically for the Illumina high-throughput sequencing platform. lt can be used for the construction of DNA and RNA libraries. The product is available in four packages, each package provides 24 types of adapters. In total, 96 types of adaptors are available. Each adaptor has two 8-base index sequences (barcode) to allow differentiation between samples when sequencing multiple samples together. This kit provides 15 μM adaptors, and the input volume should vary depending on the kit used for library construction, initial DNA input and fragment size. Please refer to the product manuals for details. In addition, the index sequences of the 96 adaptors are listed in the adaptor sequence section.

  • Kit Contents

  • Storage Condition

    Upon receipt of the kit, store it at -30°C to -15°C. Shelf life: 2 years.

    When in use, TIANSeq Dual-Index Adapter should not be placed in an environment at 25°C or above. After thawing, it is recommended to keep it on ice for later use and avoid repeated freezing and thawing. Return to -30°C to -15°C storage after use.

    Adapter Dilution Buffer can be stored at 2°C to 8°C for one month; for long-term storage, keep it at -30°C to -15°C.

  • Important Notes

    ● During use, it is recommended to keep TIANSeq Dual-Index Adapter on ice or in an ice box, and not in an environment above 25°C. To avoid damaging the advanced structure of the adapters.

    ● If dilution of the adapters is required, use the Adapter Dilution Buffer provided with the kit, not ultrapure water or other buffers.

    ● Diluted adapters are best used on the same day; long-term storage or repeated freezing and thawing of diluted adapters is not recommended.

    ● Experimental consumables should be free of nucleases and nucleic acid contamination, and low nucleic acid adsorption consumables should be preferred for the experiment. In addition, care should be taken to avoid cross-contamination between adapters during the experiment.

  • Adaptor Sequence

    The Adaptor Sequence includes the following information:

    ● D5XX Sequence

    5' -AATGATACGGCGACCACCGAGATCTACAC[D5XX]ACACTCTTTCCCTACACGAC GCTCTTCCGATCT- 3'

    ● D7XX Sequence

    5' -GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[D7XX]ATCTCGTAT GCCGTCTTCTGCTTG- 3'


Sort by

Date Date()

Date Date()

Impact Factor IF()

Impact Factor IF()